ID: 991145515

View in Genome Browser
Species Human (GRCh38)
Location 5:63298169-63298191
Sequence ACTAAAGTATGTGCACTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991145515_991145517 18 Left 991145515 5:63298169-63298191 CCTTTCAGTGCACATACTTTAGT No data
Right 991145517 5:63298210-63298232 ATACAATTAAAATTTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991145515 Original CRISPR ACTAAAGTATGTGCACTGAA AGG (reversed) Intergenic
No off target data available for this crispr