ID: 991146306

View in Genome Browser
Species Human (GRCh38)
Location 5:63309175-63309197
Sequence CTGTGTTTGTAGCTGTTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991146302_991146306 -2 Left 991146302 5:63309154-63309176 CCTCTCCTGTAACAAAACCCACT No data
Right 991146306 5:63309175-63309197 CTGTGTTTGTAGCTGTTACCTGG No data
991146303_991146306 -7 Left 991146303 5:63309159-63309181 CCTGTAACAAAACCCACTGTGTT No data
Right 991146306 5:63309175-63309197 CTGTGTTTGTAGCTGTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991146306 Original CRISPR CTGTGTTTGTAGCTGTTACC TGG Intergenic
No off target data available for this crispr