ID: 991151359

View in Genome Browser
Species Human (GRCh38)
Location 5:63375017-63375039
Sequence AAGGATAATACTGTGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991151359_991151360 -8 Left 991151359 5:63375017-63375039 CCTGCAATCACAGTATTATCCTT No data
Right 991151360 5:63375032-63375054 TTATCCTTTAAGACATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991151359 Original CRISPR AAGGATAATACTGTGATTGC AGG (reversed) Intergenic
No off target data available for this crispr