ID: 991153541

View in Genome Browser
Species Human (GRCh38)
Location 5:63400867-63400889
Sequence CTGTAGTGTTTGAGGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991153533_991153541 6 Left 991153533 5:63400838-63400860 CCCATATTTTGCCATCTTGACCA No data
Right 991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG No data
991153529_991153541 29 Left 991153529 5:63400815-63400837 CCTCTGGCTTCCCCAAATAATTG No data
Right 991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG No data
991153534_991153541 5 Left 991153534 5:63400839-63400861 CCATATTTTGCCATCTTGACCAT No data
Right 991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG No data
991153532_991153541 17 Left 991153532 5:63400827-63400849 CCAAATAATTGCCCATATTTTGC No data
Right 991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG No data
991153530_991153541 19 Left 991153530 5:63400825-63400847 CCCCAAATAATTGCCCATATTTT No data
Right 991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG No data
991153535_991153541 -5 Left 991153535 5:63400849-63400871 CCATCTTGACCATTCTTCCTGTA No data
Right 991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG No data
991153531_991153541 18 Left 991153531 5:63400826-63400848 CCCAAATAATTGCCCATATTTTG No data
Right 991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG No data
991153528_991153541 30 Left 991153528 5:63400814-63400836 CCCTCTGGCTTCCCCAAATAATT No data
Right 991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991153541 Original CRISPR CTGTAGTGTTTGAGGGCAAA GGG Intergenic
No off target data available for this crispr