ID: 991153670

View in Genome Browser
Species Human (GRCh38)
Location 5:63402529-63402551
Sequence GAGTGAAAGCCTCTGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991153670_991153672 -4 Left 991153670 5:63402529-63402551 CCTCATCACAGAGGCTTTCACTC No data
Right 991153672 5:63402548-63402570 ACTCATCATCCTGGCTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991153670 Original CRISPR GAGTGAAAGCCTCTGTGATG AGG (reversed) Intergenic
No off target data available for this crispr