ID: 991153672

View in Genome Browser
Species Human (GRCh38)
Location 5:63402548-63402570
Sequence ACTCATCATCCTGGCTAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991153670_991153672 -4 Left 991153670 5:63402529-63402551 CCTCATCACAGAGGCTTTCACTC No data
Right 991153672 5:63402548-63402570 ACTCATCATCCTGGCTAATATGG No data
991153668_991153672 12 Left 991153668 5:63402513-63402535 CCTTATTTAAATATCACCTCATC No data
Right 991153672 5:63402548-63402570 ACTCATCATCCTGGCTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991153672 Original CRISPR ACTCATCATCCTGGCTAATA TGG Intergenic
No off target data available for this crispr