ID: 991157708

View in Genome Browser
Species Human (GRCh38)
Location 5:63458641-63458663
Sequence TGGGCAGGACCTCCCAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991157701_991157708 -8 Left 991157701 5:63458626-63458648 CCCATTCCACCTCACTGGGCAGG No data
Right 991157708 5:63458641-63458663 TGGGCAGGACCTCCCAAATGGGG No data
991157697_991157708 22 Left 991157697 5:63458596-63458618 CCAGACAGCTTTGTAAAGTGAGT No data
Right 991157708 5:63458641-63458663 TGGGCAGGACCTCCCAAATGGGG No data
991157703_991157708 -9 Left 991157703 5:63458627-63458649 CCATTCCACCTCACTGGGCAGGA No data
Right 991157708 5:63458641-63458663 TGGGCAGGACCTCCCAAATGGGG No data
991157698_991157708 -3 Left 991157698 5:63458621-63458643 CCAATCCCATTCCACCTCACTGG No data
Right 991157708 5:63458641-63458663 TGGGCAGGACCTCCCAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991157708 Original CRISPR TGGGCAGGACCTCCCAAATG GGG Intergenic
No off target data available for this crispr