ID: 991163476

View in Genome Browser
Species Human (GRCh38)
Location 5:63533044-63533066
Sequence CAGGGAAAACTAGAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991163476_991163485 20 Left 991163476 5:63533044-63533066 CCAGCCTCCTCTAGTTTTCCCTG No data
Right 991163485 5:63533087-63533109 TTTCTGTTAATCATCTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991163476 Original CRISPR CAGGGAAAACTAGAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr