ID: 991164421

View in Genome Browser
Species Human (GRCh38)
Location 5:63547003-63547025
Sequence GAGGATGACTGGACTATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991164421_991164425 -8 Left 991164421 5:63547003-63547025 CCTCCCATAGTCCAGTCATCCTC No data
Right 991164425 5:63547018-63547040 TCATCCTCACAGTACCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991164421 Original CRISPR GAGGATGACTGGACTATGGG AGG (reversed) Intergenic
No off target data available for this crispr