ID: 991164425

View in Genome Browser
Species Human (GRCh38)
Location 5:63547018-63547040
Sequence TCATCCTCACAGTACCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991164419_991164425 10 Left 991164419 5:63546985-63547007 CCAATAACAGAAACCTTTCCTCC No data
Right 991164425 5:63547018-63547040 TCATCCTCACAGTACCACTGAGG No data
991164421_991164425 -8 Left 991164421 5:63547003-63547025 CCTCCCATAGTCCAGTCATCCTC No data
Right 991164425 5:63547018-63547040 TCATCCTCACAGTACCACTGAGG No data
991164420_991164425 -3 Left 991164420 5:63546998-63547020 CCTTTCCTCCCATAGTCCAGTCA No data
Right 991164425 5:63547018-63547040 TCATCCTCACAGTACCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991164425 Original CRISPR TCATCCTCACAGTACCACTG AGG Intergenic
No off target data available for this crispr