ID: 991171618

View in Genome Browser
Species Human (GRCh38)
Location 5:63633144-63633166
Sequence TCTTACATGGATATGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991171612_991171618 28 Left 991171612 5:63633093-63633115 CCGGTCAGTGGAGCAGTCAGAAC 0: 53
1: 121
2: 221
3: 286
4: 411
Right 991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991171618 Original CRISPR TCTTACATGGATATGGTTCA TGG Intergenic
No off target data available for this crispr