ID: 991173336

View in Genome Browser
Species Human (GRCh38)
Location 5:63654754-63654776
Sequence AGCCACAACCCTATTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991173336_991173341 1 Left 991173336 5:63654754-63654776 CCTACCCCAATAGGGTTGTGGCT No data
Right 991173341 5:63654778-63654800 GAATGAAATGAGCATGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991173336 Original CRISPR AGCCACAACCCTATTGGGGT AGG (reversed) Intergenic
No off target data available for this crispr