ID: 991173799

View in Genome Browser
Species Human (GRCh38)
Location 5:63661084-63661106
Sequence GATGATTGTGTGCCACCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991173797_991173799 10 Left 991173797 5:63661051-63661073 CCTCAATCAAGTGATCAAAGTTA No data
Right 991173799 5:63661084-63661106 GATGATTGTGTGCCACCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991173799 Original CRISPR GATGATTGTGTGCCACCTGA AGG Intergenic
No off target data available for this crispr