ID: 991174203

View in Genome Browser
Species Human (GRCh38)
Location 5:63667842-63667864
Sequence GCAGGTGCAACCATGTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991174198_991174203 0 Left 991174198 5:63667819-63667841 CCTGCCCCTGCTACATCACTGCT No data
Right 991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG No data
991174200_991174203 -5 Left 991174200 5:63667824-63667846 CCCTGCTACATCACTGCTGCAGG No data
Right 991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG No data
991174202_991174203 -6 Left 991174202 5:63667825-63667847 CCTGCTACATCACTGCTGCAGGT No data
Right 991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG No data
991174199_991174203 -4 Left 991174199 5:63667823-63667845 CCCCTGCTACATCACTGCTGCAG No data
Right 991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG No data
991174196_991174203 8 Left 991174196 5:63667811-63667833 CCAGCAACCCTGCCCCTGCTACA No data
Right 991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG No data
991174197_991174203 1 Left 991174197 5:63667818-63667840 CCCTGCCCCTGCTACATCACTGC No data
Right 991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG No data
991174195_991174203 29 Left 991174195 5:63667790-63667812 CCAGTGCATAGTACATGGGCACC No data
Right 991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991174203 Original CRISPR GCAGGTGCAACCATGTGCAG AGG Intergenic
No off target data available for this crispr