ID: 991174900

View in Genome Browser
Species Human (GRCh38)
Location 5:63676211-63676233
Sequence CATCTTTTGCAATAGGACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991174900_991174905 22 Left 991174900 5:63676211-63676233 CCGATGTCCTATTGCAAAAGATG No data
Right 991174905 5:63676256-63676278 ACAAAATGATTTAGAATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991174900 Original CRISPR CATCTTTTGCAATAGGACAT CGG (reversed) Intergenic
No off target data available for this crispr