ID: 991184269

View in Genome Browser
Species Human (GRCh38)
Location 5:63788998-63789020
Sequence CATGACATCCTGCAGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991184269_991184275 26 Left 991184269 5:63788998-63789020 CCTTTCCCCTGCAGGATGTCATG No data
Right 991184275 5:63789047-63789069 GCTATTCCCTGTTTCTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991184269 Original CRISPR CATGACATCCTGCAGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr