ID: 991184539

View in Genome Browser
Species Human (GRCh38)
Location 5:63792108-63792130
Sequence CAGCTGGTACCCACTCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991184539_991184540 -8 Left 991184539 5:63792108-63792130 CCAAAGTGAGTGGGTACCAGCTG No data
Right 991184540 5:63792123-63792145 ACCAGCTGCCATAGACTGCTAGG No data
991184539_991184543 9 Left 991184539 5:63792108-63792130 CCAAAGTGAGTGGGTACCAGCTG No data
Right 991184543 5:63792140-63792162 GCTAGGTTACCAGCACTCTGAGG No data
991184539_991184547 22 Left 991184539 5:63792108-63792130 CCAAAGTGAGTGGGTACCAGCTG No data
Right 991184547 5:63792153-63792175 CACTCTGAGGGTGATTCTGAGGG No data
991184539_991184544 10 Left 991184539 5:63792108-63792130 CCAAAGTGAGTGGGTACCAGCTG No data
Right 991184544 5:63792141-63792163 CTAGGTTACCAGCACTCTGAGGG No data
991184539_991184546 21 Left 991184539 5:63792108-63792130 CCAAAGTGAGTGGGTACCAGCTG No data
Right 991184546 5:63792152-63792174 GCACTCTGAGGGTGATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991184539 Original CRISPR CAGCTGGTACCCACTCACTT TGG (reversed) Intergenic
No off target data available for this crispr