ID: 991184541

View in Genome Browser
Species Human (GRCh38)
Location 5:63792124-63792146
Sequence ACCTAGCAGTCTATGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991184541_991184547 6 Left 991184541 5:63792124-63792146 CCAGCTGCCATAGACTGCTAGGT No data
Right 991184547 5:63792153-63792175 CACTCTGAGGGTGATTCTGAGGG No data
991184541_991184546 5 Left 991184541 5:63792124-63792146 CCAGCTGCCATAGACTGCTAGGT No data
Right 991184546 5:63792152-63792174 GCACTCTGAGGGTGATTCTGAGG No data
991184541_991184543 -7 Left 991184541 5:63792124-63792146 CCAGCTGCCATAGACTGCTAGGT No data
Right 991184543 5:63792140-63792162 GCTAGGTTACCAGCACTCTGAGG No data
991184541_991184544 -6 Left 991184541 5:63792124-63792146 CCAGCTGCCATAGACTGCTAGGT No data
Right 991184544 5:63792141-63792163 CTAGGTTACCAGCACTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991184541 Original CRISPR ACCTAGCAGTCTATGGCAGC TGG (reversed) Intergenic
No off target data available for this crispr