ID: 991184543

View in Genome Browser
Species Human (GRCh38)
Location 5:63792140-63792162
Sequence GCTAGGTTACCAGCACTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991184541_991184543 -7 Left 991184541 5:63792124-63792146 CCAGCTGCCATAGACTGCTAGGT No data
Right 991184543 5:63792140-63792162 GCTAGGTTACCAGCACTCTGAGG No data
991184538_991184543 10 Left 991184538 5:63792107-63792129 CCCAAAGTGAGTGGGTACCAGCT No data
Right 991184543 5:63792140-63792162 GCTAGGTTACCAGCACTCTGAGG No data
991184539_991184543 9 Left 991184539 5:63792108-63792130 CCAAAGTGAGTGGGTACCAGCTG No data
Right 991184543 5:63792140-63792162 GCTAGGTTACCAGCACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991184543 Original CRISPR GCTAGGTTACCAGCACTCTG AGG Intergenic
No off target data available for this crispr