ID: 991184547

View in Genome Browser
Species Human (GRCh38)
Location 5:63792153-63792175
Sequence CACTCTGAGGGTGATTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991184539_991184547 22 Left 991184539 5:63792108-63792130 CCAAAGTGAGTGGGTACCAGCTG No data
Right 991184547 5:63792153-63792175 CACTCTGAGGGTGATTCTGAGGG No data
991184538_991184547 23 Left 991184538 5:63792107-63792129 CCCAAAGTGAGTGGGTACCAGCT No data
Right 991184547 5:63792153-63792175 CACTCTGAGGGTGATTCTGAGGG No data
991184542_991184547 -1 Left 991184542 5:63792131-63792153 CCATAGACTGCTAGGTTACCAGC No data
Right 991184547 5:63792153-63792175 CACTCTGAGGGTGATTCTGAGGG No data
991184541_991184547 6 Left 991184541 5:63792124-63792146 CCAGCTGCCATAGACTGCTAGGT No data
Right 991184547 5:63792153-63792175 CACTCTGAGGGTGATTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991184547 Original CRISPR CACTCTGAGGGTGATTCTGA GGG Intergenic
No off target data available for this crispr