ID: 991186487

View in Genome Browser
Species Human (GRCh38)
Location 5:63814842-63814864
Sequence CAAAATGCTGATAGTGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991186484_991186487 4 Left 991186484 5:63814815-63814837 CCTAGAGACTTATTGAATTGTTG No data
Right 991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991186487 Original CRISPR CAAAATGCTGATAGTGACAT GGG Intergenic
No off target data available for this crispr