ID: 991187765

View in Genome Browser
Species Human (GRCh38)
Location 5:63830457-63830479
Sequence CAGGAGTTAGGTGGGTACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991187756_991187765 27 Left 991187756 5:63830407-63830429 CCTTTTCTTCTTTGGTCATTGCT No data
Right 991187765 5:63830457-63830479 CAGGAGTTAGGTGGGTACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991187765 Original CRISPR CAGGAGTTAGGTGGGTACAG GGG Intergenic
No off target data available for this crispr