ID: 991187871

View in Genome Browser
Species Human (GRCh38)
Location 5:63831743-63831765
Sequence CAGGAGTTAGGTGGGTACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991187871_991187880 1 Left 991187871 5:63831743-63831765 CCCCTGTACCCACCTAACTCCTG No data
Right 991187880 5:63831767-63831789 GGGTGTGCTTGACTTTCCTTAGG No data
991187871_991187881 11 Left 991187871 5:63831743-63831765 CCCCTGTACCCACCTAACTCCTG No data
Right 991187881 5:63831777-63831799 GACTTTCCTTAGGAGCAGCAAGG No data
991187871_991187883 27 Left 991187871 5:63831743-63831765 CCCCTGTACCCACCTAACTCCTG No data
Right 991187883 5:63831793-63831815 AGCAAGGACCAAAGAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991187871 Original CRISPR CAGGAGTTAGGTGGGTACAG GGG (reversed) Intergenic
No off target data available for this crispr