ID: 991188900

View in Genome Browser
Species Human (GRCh38)
Location 5:63845409-63845431
Sequence GAGAAGAAGTAGTGGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991188900_991188903 -1 Left 991188900 5:63845409-63845431 CCAGAATCCCACTACTTCTTCTC No data
Right 991188903 5:63845431-63845453 CATTACCATAGTTCTATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991188900 Original CRISPR GAGAAGAAGTAGTGGGATTC TGG (reversed) Intergenic
No off target data available for this crispr