ID: 991188903

View in Genome Browser
Species Human (GRCh38)
Location 5:63845431-63845453
Sequence CATTACCATAGTTCTATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991188898_991188903 13 Left 991188898 5:63845395-63845417 CCTTCCAAATATATCCAGAATCC No data
Right 991188903 5:63845431-63845453 CATTACCATAGTTCTATACATGG No data
991188901_991188903 -8 Left 991188901 5:63845416-63845438 CCCACTACTTCTTCTCATTACCA No data
Right 991188903 5:63845431-63845453 CATTACCATAGTTCTATACATGG No data
991188899_991188903 9 Left 991188899 5:63845399-63845421 CCAAATATATCCAGAATCCCACT No data
Right 991188903 5:63845431-63845453 CATTACCATAGTTCTATACATGG No data
991188902_991188903 -9 Left 991188902 5:63845417-63845439 CCACTACTTCTTCTCATTACCAT No data
Right 991188903 5:63845431-63845453 CATTACCATAGTTCTATACATGG No data
991188897_991188903 14 Left 991188897 5:63845394-63845416 CCCTTCCAAATATATCCAGAATC No data
Right 991188903 5:63845431-63845453 CATTACCATAGTTCTATACATGG No data
991188900_991188903 -1 Left 991188900 5:63845409-63845431 CCAGAATCCCACTACTTCTTCTC No data
Right 991188903 5:63845431-63845453 CATTACCATAGTTCTATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991188903 Original CRISPR CATTACCATAGTTCTATACA TGG Intergenic
No off target data available for this crispr