ID: 991189630

View in Genome Browser
Species Human (GRCh38)
Location 5:63854517-63854539
Sequence CAGGGTCAACACACTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991189630_991189636 11 Left 991189630 5:63854517-63854539 CCTCCATCAGTGTGTTGACCCTG No data
Right 991189636 5:63854551-63854573 ATTTAAAAAAAAAAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991189630 Original CRISPR CAGGGTCAACACACTGATGG AGG (reversed) Intergenic
No off target data available for this crispr