ID: 991192541

View in Genome Browser
Species Human (GRCh38)
Location 5:63892061-63892083
Sequence CACAGTAAGCACTCAAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991192541_991192542 -6 Left 991192541 5:63892061-63892083 CCAACATTTGAGTGCTTACTGTG No data
Right 991192542 5:63892078-63892100 ACTGTGTACTTACTATTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991192541 Original CRISPR CACAGTAAGCACTCAAATGT TGG (reversed) Intergenic
No off target data available for this crispr