ID: 991192684

View in Genome Browser
Species Human (GRCh38)
Location 5:63894212-63894234
Sequence CCACAAAGGGAAAGCCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991192684_991192690 22 Left 991192684 5:63894212-63894234 CCCTCTAGGCTTTCCCTTTGTGG No data
Right 991192690 5:63894257-63894279 AGCCATTATTTTTGATGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991192684 Original CRISPR CCACAAAGGGAAAGCCTAGA GGG (reversed) Intergenic
No off target data available for this crispr