ID: 991193798

View in Genome Browser
Species Human (GRCh38)
Location 5:63907716-63907738
Sequence AATAGTCCAAATTAATAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991193796_991193798 18 Left 991193796 5:63907675-63907697 CCTGAATTTAGAGACCTTTTGAT No data
Right 991193798 5:63907716-63907738 AATAGTCCAAATTAATAGTCTGG No data
991193797_991193798 4 Left 991193797 5:63907689-63907711 CCTTTTGATATAATTAGAGTTTA No data
Right 991193798 5:63907716-63907738 AATAGTCCAAATTAATAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991193798 Original CRISPR AATAGTCCAAATTAATAGTC TGG Intergenic
No off target data available for this crispr