ID: 991198333

View in Genome Browser
Species Human (GRCh38)
Location 5:63961115-63961137
Sequence TACACTATCTATTCCACCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991198333_991198342 29 Left 991198333 5:63961115-63961137 CCAAAGGTGGAATAGATAGTGTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 64
991198333_991198338 10 Left 991198333 5:63961115-63961137 CCAAAGGTGGAATAGATAGTGTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 991198338 5:63961148-63961170 TTGCTAATGGTGCATGCGTCGGG 0: 1
1: 0
2: 1
3: 2
4: 48
991198333_991198334 -3 Left 991198333 5:63961115-63961137 CCAAAGGTGGAATAGATAGTGTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 991198334 5:63961135-63961157 GTAGCCATGATCCTTGCTAATGG 0: 1
1: 0
2: 0
3: 3
4: 76
991198333_991198341 28 Left 991198333 5:63961115-63961137 CCAAAGGTGGAATAGATAGTGTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 991198341 5:63961166-63961188 TCGGGGTCCGAGCGGTCTTCCGG 0: 1
1: 0
2: 0
3: 2
4: 28
991198333_991198337 9 Left 991198333 5:63961115-63961137 CCAAAGGTGGAATAGATAGTGTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 991198337 5:63961147-63961169 CTTGCTAATGGTGCATGCGTCGG 0: 1
1: 0
2: 0
3: 4
4: 58
991198333_991198339 11 Left 991198333 5:63961115-63961137 CCAAAGGTGGAATAGATAGTGTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 991198339 5:63961149-63961171 TGCTAATGGTGCATGCGTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 25
991198333_991198343 30 Left 991198333 5:63961115-63961137 CCAAAGGTGGAATAGATAGTGTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 991198343 5:63961168-63961190 GGGGTCCGAGCGGTCTTCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 43
991198333_991198340 20 Left 991198333 5:63961115-63961137 CCAAAGGTGGAATAGATAGTGTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 991198340 5:63961158-63961180 TGCATGCGTCGGGGTCCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991198333 Original CRISPR TACACTATCTATTCCACCTT TGG (reversed) Exonic
903417441 1:23193609-23193631 TACACCATCTACTCCACCTGTGG - Exonic
911177785 1:94834359-94834381 TATTCAATCTATTCCAGCTTTGG - Intronic
914972753 1:152325682-152325704 TAATCTATGTATTCCATCTTTGG + Intergenic
915323726 1:155070068-155070090 CACACTGTCTCTTCCACCTCTGG + Intergenic
918481960 1:184988066-184988088 TACACAATCTATTCAACTGTGGG + Intergenic
919873503 1:201843026-201843048 TACCCAAACTTTTCCACCTTTGG + Intronic
922008377 1:221555434-221555456 TTCACTATCTTTTCAGCCTTGGG - Intergenic
923460351 1:234204721-234204743 TACACTAACAAATCCATCTTTGG + Intronic
1069263120 10:66423927-66423949 AACATTAACTCTTCCACCTTTGG - Intronic
1070215141 10:74371089-74371111 TATACTAGCTATTGCAACTTTGG + Intronic
1070368208 10:75756775-75756797 TTTACTAGCTATGCCACCTTGGG - Intronic
1074296503 10:112194160-112194182 TACACTCTCTTTTCCAGCCTTGG - Intronic
1075959306 10:126554136-126554158 GTCACTATCTGTTCCACCGTTGG - Intronic
1079594579 11:22226516-22226538 TACCCTATCTATTCCAGCCTGGG + Intronic
1080880450 11:36314824-36314846 TTCACTATCTATGTGACCTTGGG + Intronic
1083561076 11:63673506-63673528 TTCACTAGCTATGCAACCTTGGG + Intergenic
1084551760 11:69847793-69847815 CACAAGATCTATTCCACCTATGG - Intergenic
1085943808 11:81241198-81241220 TATGCTATATATTCCACATTAGG - Intergenic
1086269792 11:85048485-85048507 TACATTGTCTTTTCCACCTGTGG + Intronic
1089463903 11:118670970-118670992 TACCCAAACTTTTCCACCTTTGG + Intronic
1093164043 12:15785144-15785166 TACAATCTGCATTCCACCTTGGG - Intronic
1093740604 12:22681041-22681063 TATACTATCTCTTTCACATTTGG - Intronic
1094249846 12:28347401-28347423 TACCCTATCTTTTTCACCTTTGG + Intronic
1094330545 12:29287538-29287560 TACAGTGTCTCTTTCACCTTGGG + Intronic
1096448254 12:51714843-51714865 TAAACTATGAATTCCAACTTAGG - Intronic
1099976812 12:89554350-89554372 TAGGTTATCTATTTCACCTTGGG - Intergenic
1102432448 12:112894162-112894184 TTTACCATCTATCCCACCTTAGG - Intronic
1103188887 12:118983516-118983538 TCTGCTATCTATTCCACCTTTGG + Intronic
1109525739 13:63572553-63572575 TACACTACCTGTTCCAAATTTGG - Intergenic
1109821151 13:67657016-67657038 TACTTTCCCTATTCCACCTTTGG + Intergenic
1111306440 13:86419241-86419263 TATACTATCTTTTCCAAATTTGG + Intergenic
1114036095 14:18629201-18629223 TACAGTGTCTCTTTCACCTTGGG + Intergenic
1114122543 14:19685830-19685852 TACAGTGTCTCTTTCACCTTGGG - Intergenic
1114145504 14:19972148-19972170 CACACTTTCCATTTCACCTTAGG + Intergenic
1116115493 14:40644442-40644464 TAAACTTTCTTTTCCACTTTGGG + Intergenic
1118390346 14:65290376-65290398 CACACCATCTATTCCAGCCTGGG + Intergenic
1121200355 14:92111809-92111831 TACACTTTCTATGTCATCTTAGG + Intergenic
1125620810 15:41060050-41060072 TAAACCATTTATTCCACCATTGG - Intronic
1129954947 15:79627876-79627898 GACACCATCTATTTCATCTTTGG - Intergenic
1137008900 16:35304131-35304153 AACACTCTCTGTTCCACCTTAGG + Intergenic
1137021198 16:35429313-35429335 CACACTCTCTGTACCACCTTAGG + Intergenic
1154005367 18:10523072-10523094 CACACTATCGATTCTAGCTTGGG + Intergenic
1157114565 18:44850990-44851012 CACAGGATCTATTCAACCTTGGG + Intronic
1164030034 19:21395567-21395589 GCCACTATCTGTTCCACCCTCGG + Intergenic
1164226572 19:23251284-23251306 GCCACTATCTGTTCCACCCTGGG - Intergenic
926889906 2:17630001-17630023 TACACTATCGTGCCCACCTTTGG - Intronic
927306458 2:21579096-21579118 TACATTATCTATTCCAACAGTGG - Intergenic
935475196 2:103511432-103511454 TACATTATCTATTTCATATTGGG + Intergenic
936085363 2:109463882-109463904 TACCCTGTCTATACCACCTCTGG - Intronic
938075902 2:128336221-128336243 TTCACTCTCTTTTCTACCTTGGG - Intergenic
938274298 2:130003748-130003770 TACAGTGTCTCTTTCACCTTGGG - Intergenic
939845479 2:147240921-147240943 TACACTATCTGGTCCATCTCTGG + Intergenic
939872825 2:147543825-147543847 TTCATTAGCTATTCCAGCTTGGG - Intergenic
941594964 2:167465255-167465277 TACACACTGTATTCCACCATGGG - Intergenic
942492339 2:176502045-176502067 CACACCATCTCTTCCACCTAAGG - Intergenic
944841329 2:203626656-203626678 TATAGGAACTATTCCACCTTAGG - Intergenic
947933884 2:233986583-233986605 TACATTATCTGTTAAACCTTTGG + Intronic
1171863979 20:30462988-30463010 GACACTTCCTATTTCACCTTAGG + Intergenic
1177001204 21:15615300-15615322 GACTATGTCTATTCCACCTTTGG - Intergenic
1178088835 21:29140228-29140250 TACACTATCTGTAACAACTTGGG + Intronic
1179069288 21:38056610-38056632 CACACTTTCTTTTGCACCTTGGG + Intronic
1180460222 22:15556263-15556285 TACAGTGTCTCTTTCACCTTGGG + Intergenic
1181983973 22:26786444-26786466 GACTCTATCTGGTCCACCTTTGG - Intergenic
1184904897 22:47475366-47475388 TCCACTATCTTGTCCACTTTAGG - Intronic
951306972 3:21076193-21076215 TAGACTATCTATTTCCCCATTGG + Intergenic
952321627 3:32283279-32283301 TTCTCTGTCTTTTCCACCTTGGG + Intronic
957562433 3:81839880-81839902 TACACAATCTATTTCCACTTGGG - Intergenic
961433410 3:126899349-126899371 TTCACTATCCATTCAAGCTTTGG - Intronic
964198701 3:154093097-154093119 TACACTATTTTTTCTACTTTTGG + Intergenic
965328083 3:167332821-167332843 TCCATTATCAATTCTACCTTTGG + Intronic
965959828 3:174415612-174415634 TACACTATTTGTTTCACGTTTGG - Intergenic
967637107 3:191815499-191815521 TCCACTATCCTTTCCACCTCTGG - Intergenic
974440508 4:61909705-61909727 AGCACTATCTTTTCCACCTGGGG - Exonic
975912774 4:79287887-79287909 TGCACTCTGTATTCCATCTTTGG + Intronic
976558227 4:86474344-86474366 AACACTATGGATTCAACCTTAGG - Intronic
978057878 4:104295268-104295290 TCCACTATCTATTCCTTTTTTGG + Intergenic
978264917 4:106812160-106812182 TACTCTATCAATTCCATTTTTGG + Intergenic
979410506 4:120372790-120372812 TATACCATCTATTACATCTTGGG + Intergenic
980002283 4:127504298-127504320 TACATTATCTATTCTACTTTAGG - Intergenic
980125272 4:128768369-128768391 TACTCTCACTCTTCCACCTTCGG + Intergenic
983187291 4:164714765-164714787 TACAGTCTCTCTCCCACCTTGGG - Intergenic
983328738 4:166295706-166295728 TACACTTTCTATTACATTTTAGG - Intergenic
983725962 4:170926236-170926258 TACACTATCTAACCCACTCTGGG + Intergenic
983928505 4:173428383-173428405 TACACTTTCTGTGGCACCTTAGG + Intergenic
991198333 5:63961115-63961137 TACACTATCTATTCCACCTTTGG - Exonic
996201517 5:120680928-120680950 TATAGTATCTATACCAACTTAGG - Intronic
1000734178 5:164878739-164878761 TAGAGTCTCTATTCTACCTTGGG - Intergenic
1001131035 5:169063563-169063585 TCCACAATCTATTCCACCTGTGG + Intronic
1008343940 6:50403065-50403087 TGCACTATTTATTTCACCCTTGG - Intergenic
1009254403 6:61364504-61364526 GACACTTTCTATTCTACCATAGG - Intergenic
1014039657 6:116811271-116811293 AACACTATCTATTCATCCTTAGG + Intronic
1015182688 6:130377998-130378020 TGCACTTTCTATTCCTCCTGCGG - Intronic
1015608826 6:134991570-134991592 TACAGTATCTGGTCCACATTAGG + Intronic
1021512493 7:21449385-21449407 TACACTATCTTTTAAAACTTTGG + Intronic
1023473331 7:40549463-40549485 TACACTGTCTTTTCCATCTTTGG - Intronic
1025766739 7:64463053-64463075 GACAGTATCTGTTCCACCCTCGG + Intergenic
1027492030 7:78840126-78840148 TACATTATCAATTCAACATTTGG + Intronic
1028865121 7:95700497-95700519 TAGATTATCTATTTCACCTTTGG + Intergenic
1032827607 7:135587445-135587467 TTAAATATCTATTCCACTTTAGG - Intronic
1036403989 8:8438142-8438164 TAGACTGTCCACTCCACCTTGGG - Intergenic
1039758994 8:40553691-40553713 TTCATTATCTATGCAACCTTAGG - Intronic
1039910061 8:41819469-41819491 AACACTATCCCTTCCACCTGTGG - Intronic
1041414454 8:57592288-57592310 GACACTAGCTATTTCACCCTTGG - Intergenic
1041778241 8:61548417-61548439 TACATTTTCTTTTCCCCCTTAGG + Intronic
1041896239 8:62927438-62927460 TACAGTATCTATTGCACTTTGGG + Intronic
1042093310 8:65182986-65183008 TCCAGTATCTATACCAACTTGGG + Intergenic
1044817296 8:96126148-96126170 TTCACTTTCTCCTCCACCTTAGG - Intergenic
1045219604 8:100185720-100185742 TACAATCTTTTTTCCACCTTTGG + Intronic
1045904729 8:107331329-107331351 TAAACTATTTATTTTACCTTGGG - Intronic
1051790071 9:20791828-20791850 TACACTATCTATCCTTCCTTTGG - Intronic
1053686538 9:40532519-40532541 GATACTACCTTTTCCACCTTAGG - Intergenic
1053936748 9:43164928-43164950 GATACTACCTTTTCCACCTTAGG - Intergenic
1054711835 9:68518208-68518230 TACAGTCTGTATACCACCTTTGG - Intronic
1056631266 9:88295006-88295028 TACCCAAACTTTTCCACCTTGGG + Intergenic
1058556785 9:106177266-106177288 TACACTTTCTTTTCCATCTTTGG + Intergenic
1059536797 9:115088099-115088121 TTCAATATCTATGCCACATTTGG + Intronic
1060333311 9:122696383-122696405 TACAATATTTATTTTACCTTAGG + Intergenic
1187197830 X:17105085-17105107 TTTACTAGCTATGCCACCTTGGG - Intronic
1189167597 X:38876320-38876342 TAAAGTATTTATTCCATCTTGGG + Intergenic
1190235061 X:48608817-48608839 TTCATTATTTATTCCCCCTTAGG - Exonic
1190425691 X:50332832-50332854 TACACAAACTATTTCAACTTGGG - Intronic
1195445266 X:104945661-104945683 TACACTATACATTTCACTTTGGG - Intronic
1199723061 X:150556992-150557014 TACCCAAACTTTTCCACCTTTGG - Intergenic