ID: 991198342

View in Genome Browser
Species Human (GRCh38)
Location 5:63961167-63961189
Sequence CGGGGTCCGAGCGGTCTTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991198335_991198342 5 Left 991198335 5:63961139-63961161 CCATGATCCTTGCTAATGGTGCA 0: 1
1: 0
2: 0
3: 10
4: 84
Right 991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 64
991198336_991198342 -2 Left 991198336 5:63961146-63961168 CCTTGCTAATGGTGCATGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 14
Right 991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 64
991198333_991198342 29 Left 991198333 5:63961115-63961137 CCAAAGGTGGAATAGATAGTGTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991198342 Original CRISPR CGGGGTCCGAGCGGTCTTCC GGG Exonic
902394780 1:16126664-16126686 CGTGGTCTGAGCGCTTTTCCAGG - Intronic
903834164 1:26191904-26191926 AGGGGTCAGAGCTGGCTTCCTGG + Intronic
904236946 1:29122477-29122499 CTTGATCCGAGCGGTCTTCCCGG - Exonic
906524515 1:46486359-46486381 CAGGGTCCCAGCTGTCTGCCCGG - Intergenic
914360568 1:146932614-146932636 CGTGGGCCCATCGGTCTTCCGGG - Intergenic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
915517259 1:156420806-156420828 CTGGGTCGCTGCGGTCTTCCCGG - Intronic
918236828 1:182589212-182589234 CGGGCTGCAAGCAGTCTTCCAGG - Exonic
918390204 1:184051801-184051823 CTGGGTCCGGGCGGTGTTCGCGG + Exonic
921217609 1:212950867-212950889 CGGGGTCCGGGAGGGCTTCCTGG + Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1066291996 10:34022739-34022761 AGGGGACAGAGAGGTCTTCCTGG + Intergenic
1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG + Intergenic
1073812237 10:107164259-107164281 CGGGGACCGAGCGCTATCCCTGG - Exonic
1078533150 11:12152484-12152506 CAGGGTCTGAGTGTTCTTCCTGG + Intronic
1081968817 11:47185167-47185189 TCGGCTCCGAGAGGTCTTCCTGG + Intronic
1085398024 11:76217308-76217330 AGGGGTCCTGGCTGTCTTCCTGG + Intergenic
1089770080 11:120796542-120796564 GGGGGTCAGAGAGGGCTTCCTGG + Intronic
1092256342 12:6928338-6928360 CTGGCTCCGAGCGGGATTCCGGG - Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1103994477 12:124820373-124820395 AGGAGTCCGGGAGGTCTTCCTGG + Intronic
1105041771 12:132966766-132966788 CGAGGTCAGGGGGGTCTTCCTGG - Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1132536477 16:483886-483908 CGGGGGACGGGCGGGCTTCCAGG - Intronic
1132633390 16:930622-930644 CGGGGGCTGTGCGGACTTCCCGG + Intronic
1135177707 16:20245491-20245513 AGGGGTCCTTGCAGTCTTCCAGG - Intergenic
1135205451 16:20480133-20480155 CAGGGTCCCAGGGGGCTTCCTGG + Intronic
1135213457 16:20543679-20543701 CAGGGTCCCAGGGGGCTTCCTGG - Intronic
1136988825 16:35139775-35139797 CGGGGTCCAATGGGTGTTCCTGG + Intergenic
1138281165 16:55773145-55773167 CGGGGTGTGAGGGGTCCTCCTGG + Intergenic
1138374562 16:56553847-56553869 AGGGGCCTGAGCAGTCTTCCAGG + Intergenic
1142354766 16:89597167-89597189 CGGGGTCTGCGGGGTCTGCCTGG + Exonic
1144632428 17:16881012-16881034 CGGGGTCCCAGTGGGCTTGCTGG + Intergenic
1144638141 17:16923902-16923924 CGGGGTCCCAGTGGGCTTGCTGG + Intergenic
1149958850 17:61084470-61084492 CGGGGTCAGAGCGGACTGGCTGG - Exonic
1152673813 17:81626220-81626242 CGGGGTTCAAGCGGTTTTCCTGG - Intronic
1160805935 19:992160-992182 CAGGGCCCGCGGGGTCTTCCGGG - Intronic
1160955076 19:1687521-1687543 AGGGGTCAGAGAGGGCTTCCTGG + Intergenic
1161316601 19:3620299-3620321 CGGGGACCGTGCGGTCTGCAGGG + Intronic
1161925711 19:7297552-7297574 CTGGGTTCAAGCGATCTTCCTGG + Intergenic
1162489979 19:10986255-10986277 CGGGGCCCCAGATGTCTTCCGGG + Exonic
1162733822 19:12734686-12734708 CGGGGCCGGAGCGGCCTTCCCGG - Exonic
927690506 2:25204669-25204691 CGGGGCCCGGGCGGGCGTCCGGG - Intergenic
930728820 2:54708963-54708985 CAGGCTCCGAGGGGTCTCCCAGG - Intergenic
932781777 2:74563150-74563172 CTGGGTTCAAGCAGTCTTCCTGG - Intronic
935543819 2:104379266-104379288 CTGGGCACGAGCTGTCTTCCAGG + Intergenic
1180064434 21:45405445-45405467 CGGGGTCCGCGCGGCCTCCGCGG + Intronic
1182287267 22:29255753-29255775 GGGGGTCAGGGAGGTCTTCCTGG + Intronic
950106109 3:10389851-10389873 CTGGGTCCCAGCTGTCCTCCTGG - Intronic
950433875 3:12967352-12967374 CGCGGGGCGAGCGGCCTTCCCGG - Intronic
962277873 3:134029679-134029701 CGGAGTCCGCGGGGTCTTCCGGG - Intronic
968061518 3:195729691-195729713 TGGGGTCAGTGAGGTCTTCCGGG - Exonic
968579295 4:1382476-1382498 CTGGGACCGCGCGGCCTTCCTGG - Intronic
981120141 4:141040128-141040150 CGGGGTTCTTGCAGTCTTCCAGG - Intronic
986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG + Intronic
988225208 5:28404478-28404500 CGGGGGTAGAGGGGTCTTCCCGG - Intergenic
988609646 5:32712430-32712452 GGGGGTCCACGAGGTCTTCCAGG + Exonic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
992726471 5:79612444-79612466 CGGGGTCACGTCGGTCTTCCGGG + Exonic
1002140550 5:177134687-177134709 CGGGGTCCGAGGGGGGCTCCTGG - Intronic
1017813083 6:157998138-157998160 AGGGGAGCGAGGGGTCTTCCTGG + Intronic
1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG + Intronic
1025825320 7:65006348-65006370 CGGGGTCCGAGCTGTCAGCCCGG + Intronic
1031836361 7:126685484-126685506 AGGGGTCAGAGGGGCCTTCCTGG - Intronic
1035323581 7:158050612-158050634 CGGGGCCCGAGCTGTGCTCCTGG - Intronic
1041201431 8:55454287-55454309 CGGGGTCAATGCGGCCTTCCAGG - Intronic
1049766559 8:144357961-144357983 CGTGGTCCGAGCGGTGGCCCGGG - Intronic
1060192122 9:121599816-121599838 CGGGATCCGAGCGGCATCCCGGG + Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1062401647 9:136375397-136375419 CGGGGTACGGGAGGCCTTCCAGG + Intergenic
1195129873 X:101841207-101841229 CGGGGGCAGAGAGGTCTGCCTGG - Intronic
1195176363 X:102318616-102318638 CGGGGGCAGAGAGGTCTGCCTGG + Intronic
1195182501 X:102368477-102368499 CGGGGGCAGAGAGGTCTGCCTGG - Intronic
1200065246 X:153501698-153501720 CGGGGGCCGGGCAGGCTTCCCGG - Intronic