ID: 991198342

View in Genome Browser
Species Human (GRCh38)
Location 5:63961167-63961189
Sequence CGGGGTCCGAGCGGTCTTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991198336_991198342 -2 Left 991198336 5:63961146-63961168 CCTTGCTAATGGTGCATGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 14
Right 991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 64
991198335_991198342 5 Left 991198335 5:63961139-63961161 CCATGATCCTTGCTAATGGTGCA 0: 1
1: 0
2: 0
3: 10
4: 84
Right 991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 64
991198333_991198342 29 Left 991198333 5:63961115-63961137 CCAAAGGTGGAATAGATAGTGTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991198342 Original CRISPR CGGGGTCCGAGCGGTCTTCC GGG Exonic