ID: 991202263

View in Genome Browser
Species Human (GRCh38)
Location 5:64008296-64008318
Sequence CTGTAAACACTGAGGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991202263_991202267 5 Left 991202263 5:64008296-64008318 CCATGCTTCCTCAGTGTTTACAG No data
Right 991202267 5:64008324-64008346 CTAAATATCACTGAATAAGGTGG No data
991202263_991202269 7 Left 991202263 5:64008296-64008318 CCATGCTTCCTCAGTGTTTACAG No data
Right 991202269 5:64008326-64008348 AAATATCACTGAATAAGGTGGGG No data
991202263_991202268 6 Left 991202263 5:64008296-64008318 CCATGCTTCCTCAGTGTTTACAG No data
Right 991202268 5:64008325-64008347 TAAATATCACTGAATAAGGTGGG No data
991202263_991202266 2 Left 991202263 5:64008296-64008318 CCATGCTTCCTCAGTGTTTACAG No data
Right 991202266 5:64008321-64008343 ATTCTAAATATCACTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991202263 Original CRISPR CTGTAAACACTGAGGAAGCA TGG (reversed) Intergenic
No off target data available for this crispr