ID: 991202266

View in Genome Browser
Species Human (GRCh38)
Location 5:64008321-64008343
Sequence ATTCTAAATATCACTGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991202262_991202266 3 Left 991202262 5:64008295-64008317 CCCATGCTTCCTCAGTGTTTACA No data
Right 991202266 5:64008321-64008343 ATTCTAAATATCACTGAATAAGG No data
991202265_991202266 -6 Left 991202265 5:64008304-64008326 CCTCAGTGTTTACAGGTATTCTA No data
Right 991202266 5:64008321-64008343 ATTCTAAATATCACTGAATAAGG No data
991202263_991202266 2 Left 991202263 5:64008296-64008318 CCATGCTTCCTCAGTGTTTACAG No data
Right 991202266 5:64008321-64008343 ATTCTAAATATCACTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991202266 Original CRISPR ATTCTAAATATCACTGAATA AGG Intergenic
No off target data available for this crispr