ID: 991202891

View in Genome Browser
Species Human (GRCh38)
Location 5:64014769-64014791
Sequence GTGTCTATGAAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991202891_991202897 7 Left 991202891 5:64014769-64014791 CCCTCTTCCTTCTTCATAGACAC No data
Right 991202897 5:64014799-64014821 TTTATTGAAACCTCACGTGGTGG No data
991202891_991202896 4 Left 991202891 5:64014769-64014791 CCCTCTTCCTTCTTCATAGACAC No data
Right 991202896 5:64014796-64014818 CTTTTTATTGAAACCTCACGTGG No data
991202891_991202899 29 Left 991202891 5:64014769-64014791 CCCTCTTCCTTCTTCATAGACAC No data
Right 991202899 5:64014821-64014843 GAAAGACAAGAGAGCTCTCTAGG No data
991202891_991202900 30 Left 991202891 5:64014769-64014791 CCCTCTTCCTTCTTCATAGACAC No data
Right 991202900 5:64014822-64014844 AAAGACAAGAGAGCTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991202891 Original CRISPR GTGTCTATGAAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr