ID: 991203842

View in Genome Browser
Species Human (GRCh38)
Location 5:64026213-64026235
Sequence TTACTTTGAAGGTATCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991203842_991203845 23 Left 991203842 5:64026213-64026235 CCAGTAGGATACCTTCAAAGTAA No data
Right 991203845 5:64026259-64026281 TCCTGTGTCCATACATTTAATGG No data
991203842_991203847 26 Left 991203842 5:64026213-64026235 CCAGTAGGATACCTTCAAAGTAA No data
Right 991203847 5:64026262-64026284 TGTGTCCATACATTTAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991203842 Original CRISPR TTACTTTGAAGGTATCCTAC TGG (reversed) Intergenic
No off target data available for this crispr