ID: 991203845

View in Genome Browser
Species Human (GRCh38)
Location 5:64026259-64026281
Sequence TCCTGTGTCCATACATTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991203844_991203845 -3 Left 991203844 5:64026239-64026261 CCATATCAAACTCTGTTTCATCC No data
Right 991203845 5:64026259-64026281 TCCTGTGTCCATACATTTAATGG No data
991203843_991203845 12 Left 991203843 5:64026224-64026246 CCTTCAAAGTAACAGCCATATCA No data
Right 991203845 5:64026259-64026281 TCCTGTGTCCATACATTTAATGG No data
991203841_991203845 24 Left 991203841 5:64026212-64026234 CCCAGTAGGATACCTTCAAAGTA No data
Right 991203845 5:64026259-64026281 TCCTGTGTCCATACATTTAATGG No data
991203842_991203845 23 Left 991203842 5:64026213-64026235 CCAGTAGGATACCTTCAAAGTAA No data
Right 991203845 5:64026259-64026281 TCCTGTGTCCATACATTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991203845 Original CRISPR TCCTGTGTCCATACATTTAA TGG Intergenic
No off target data available for this crispr