ID: 991203911

View in Genome Browser
Species Human (GRCh38)
Location 5:64027362-64027384
Sequence CTTTAAGAAAAGATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991203908_991203911 8 Left 991203908 5:64027331-64027353 CCTGAAGAAAGGGACAGTTGAGT No data
Right 991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991203911 Original CRISPR CTTTAAGAAAAGATGGAGCT TGG Intergenic
No off target data available for this crispr