ID: 991209249

View in Genome Browser
Species Human (GRCh38)
Location 5:64085212-64085234
Sequence AGGGAGAGTGCAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991209249_991209257 24 Left 991209249 5:64085212-64085234 CCCACAGTCACTGCACTCTCCCT No data
Right 991209257 5:64085259-64085281 ATGCAATGTAGCCAGTGCCAGGG No data
991209249_991209256 23 Left 991209249 5:64085212-64085234 CCCACAGTCACTGCACTCTCCCT No data
Right 991209256 5:64085258-64085280 CATGCAATGTAGCCAGTGCCAGG No data
991209249_991209258 25 Left 991209249 5:64085212-64085234 CCCACAGTCACTGCACTCTCCCT No data
Right 991209258 5:64085260-64085282 TGCAATGTAGCCAGTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991209249 Original CRISPR AGGGAGAGTGCAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr