ID: 991209251

View in Genome Browser
Species Human (GRCh38)
Location 5:64085231-64085253
Sequence GAGACTGTGAGCTTGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991209251_991209262 21 Left 991209251 5:64085231-64085253 CCCTCTCCCAAGCTCACAGTCTC No data
Right 991209262 5:64085275-64085297 GCCAGGGGATGCGGGAAGAGTGG No data
991209251_991209258 6 Left 991209251 5:64085231-64085253 CCCTCTCCCAAGCTCACAGTCTC No data
Right 991209258 5:64085260-64085282 TGCAATGTAGCCAGTGCCAGGGG No data
991209251_991209257 5 Left 991209251 5:64085231-64085253 CCCTCTCCCAAGCTCACAGTCTC No data
Right 991209257 5:64085259-64085281 ATGCAATGTAGCCAGTGCCAGGG No data
991209251_991209256 4 Left 991209251 5:64085231-64085253 CCCTCTCCCAAGCTCACAGTCTC No data
Right 991209256 5:64085258-64085280 CATGCAATGTAGCCAGTGCCAGG No data
991209251_991209264 27 Left 991209251 5:64085231-64085253 CCCTCTCCCAAGCTCACAGTCTC No data
Right 991209264 5:64085281-64085303 GGATGCGGGAAGAGTGGTGTTGG No data
991209251_991209259 12 Left 991209251 5:64085231-64085253 CCCTCTCCCAAGCTCACAGTCTC No data
Right 991209259 5:64085266-64085288 GTAGCCAGTGCCAGGGGATGCGG No data
991209251_991209260 13 Left 991209251 5:64085231-64085253 CCCTCTCCCAAGCTCACAGTCTC No data
Right 991209260 5:64085267-64085289 TAGCCAGTGCCAGGGGATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991209251 Original CRISPR GAGACTGTGAGCTTGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr