ID: 991209253

View in Genome Browser
Species Human (GRCh38)
Location 5:64085237-64085259
Sequence TGGAGAGAGACTGTGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991209253_991209260 7 Left 991209253 5:64085237-64085259 CCCAAGCTCACAGTCTCTCTCCA No data
Right 991209260 5:64085267-64085289 TAGCCAGTGCCAGGGGATGCGGG No data
991209253_991209262 15 Left 991209253 5:64085237-64085259 CCCAAGCTCACAGTCTCTCTCCA No data
Right 991209262 5:64085275-64085297 GCCAGGGGATGCGGGAAGAGTGG No data
991209253_991209264 21 Left 991209253 5:64085237-64085259 CCCAAGCTCACAGTCTCTCTCCA No data
Right 991209264 5:64085281-64085303 GGATGCGGGAAGAGTGGTGTTGG No data
991209253_991209259 6 Left 991209253 5:64085237-64085259 CCCAAGCTCACAGTCTCTCTCCA No data
Right 991209259 5:64085266-64085288 GTAGCCAGTGCCAGGGGATGCGG No data
991209253_991209257 -1 Left 991209253 5:64085237-64085259 CCCAAGCTCACAGTCTCTCTCCA No data
Right 991209257 5:64085259-64085281 ATGCAATGTAGCCAGTGCCAGGG No data
991209253_991209256 -2 Left 991209253 5:64085237-64085259 CCCAAGCTCACAGTCTCTCTCCA No data
Right 991209256 5:64085258-64085280 CATGCAATGTAGCCAGTGCCAGG No data
991209253_991209258 0 Left 991209253 5:64085237-64085259 CCCAAGCTCACAGTCTCTCTCCA No data
Right 991209258 5:64085260-64085282 TGCAATGTAGCCAGTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991209253 Original CRISPR TGGAGAGAGACTGTGAGCTT GGG (reversed) Intergenic
No off target data available for this crispr