ID: 991209254

View in Genome Browser
Species Human (GRCh38)
Location 5:64085238-64085260
Sequence ATGGAGAGAGACTGTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991209254_991209259 5 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209259 5:64085266-64085288 GTAGCCAGTGCCAGGGGATGCGG No data
991209254_991209260 6 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209260 5:64085267-64085289 TAGCCAGTGCCAGGGGATGCGGG No data
991209254_991209256 -3 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209256 5:64085258-64085280 CATGCAATGTAGCCAGTGCCAGG No data
991209254_991209265 30 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209265 5:64085291-64085313 AGAGTGGTGTTGGCAGTCCAAGG No data
991209254_991209264 20 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209264 5:64085281-64085303 GGATGCGGGAAGAGTGGTGTTGG No data
991209254_991209257 -2 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209257 5:64085259-64085281 ATGCAATGTAGCCAGTGCCAGGG No data
991209254_991209262 14 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209262 5:64085275-64085297 GCCAGGGGATGCGGGAAGAGTGG No data
991209254_991209258 -1 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209258 5:64085260-64085282 TGCAATGTAGCCAGTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991209254 Original CRISPR ATGGAGAGAGACTGTGAGCT TGG (reversed) Intergenic