ID: 991209259

View in Genome Browser
Species Human (GRCh38)
Location 5:64085266-64085288
Sequence GTAGCCAGTGCCAGGGGATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991209250_991209259 30 Left 991209250 5:64085213-64085235 CCACAGTCACTGCACTCTCCCTC 0: 7
1: 40
2: 114
3: 208
4: 607
Right 991209259 5:64085266-64085288 GTAGCCAGTGCCAGGGGATGCGG No data
991209251_991209259 12 Left 991209251 5:64085231-64085253 CCCTCTCCCAAGCTCACAGTCTC No data
Right 991209259 5:64085266-64085288 GTAGCCAGTGCCAGGGGATGCGG No data
991209252_991209259 11 Left 991209252 5:64085232-64085254 CCTCTCCCAAGCTCACAGTCTCT No data
Right 991209259 5:64085266-64085288 GTAGCCAGTGCCAGGGGATGCGG No data
991209254_991209259 5 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209259 5:64085266-64085288 GTAGCCAGTGCCAGGGGATGCGG No data
991209253_991209259 6 Left 991209253 5:64085237-64085259 CCCAAGCTCACAGTCTCTCTCCA No data
Right 991209259 5:64085266-64085288 GTAGCCAGTGCCAGGGGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991209259 Original CRISPR GTAGCCAGTGCCAGGGGATG CGG Intergenic
No off target data available for this crispr