ID: 991209260

View in Genome Browser
Species Human (GRCh38)
Location 5:64085267-64085289
Sequence TAGCCAGTGCCAGGGGATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991209252_991209260 12 Left 991209252 5:64085232-64085254 CCTCTCCCAAGCTCACAGTCTCT No data
Right 991209260 5:64085267-64085289 TAGCCAGTGCCAGGGGATGCGGG No data
991209253_991209260 7 Left 991209253 5:64085237-64085259 CCCAAGCTCACAGTCTCTCTCCA No data
Right 991209260 5:64085267-64085289 TAGCCAGTGCCAGGGGATGCGGG No data
991209254_991209260 6 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209260 5:64085267-64085289 TAGCCAGTGCCAGGGGATGCGGG No data
991209251_991209260 13 Left 991209251 5:64085231-64085253 CCCTCTCCCAAGCTCACAGTCTC No data
Right 991209260 5:64085267-64085289 TAGCCAGTGCCAGGGGATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991209260 Original CRISPR TAGCCAGTGCCAGGGGATGC GGG Intergenic
No off target data available for this crispr