ID: 991209264

View in Genome Browser
Species Human (GRCh38)
Location 5:64085281-64085303
Sequence GGATGCGGGAAGAGTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991209251_991209264 27 Left 991209251 5:64085231-64085253 CCCTCTCCCAAGCTCACAGTCTC No data
Right 991209264 5:64085281-64085303 GGATGCGGGAAGAGTGGTGTTGG No data
991209255_991209264 1 Left 991209255 5:64085257-64085279 CCATGCAATGTAGCCAGTGCCAG No data
Right 991209264 5:64085281-64085303 GGATGCGGGAAGAGTGGTGTTGG No data
991209254_991209264 20 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209264 5:64085281-64085303 GGATGCGGGAAGAGTGGTGTTGG No data
991209252_991209264 26 Left 991209252 5:64085232-64085254 CCTCTCCCAAGCTCACAGTCTCT No data
Right 991209264 5:64085281-64085303 GGATGCGGGAAGAGTGGTGTTGG No data
991209253_991209264 21 Left 991209253 5:64085237-64085259 CCCAAGCTCACAGTCTCTCTCCA No data
Right 991209264 5:64085281-64085303 GGATGCGGGAAGAGTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991209264 Original CRISPR GGATGCGGGAAGAGTGGTGT TGG Intergenic
No off target data available for this crispr