ID: 991209265

View in Genome Browser
Species Human (GRCh38)
Location 5:64085291-64085313
Sequence AGAGTGGTGTTGGCAGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991209255_991209265 11 Left 991209255 5:64085257-64085279 CCATGCAATGTAGCCAGTGCCAG No data
Right 991209265 5:64085291-64085313 AGAGTGGTGTTGGCAGTCCAAGG No data
991209254_991209265 30 Left 991209254 5:64085238-64085260 CCAAGCTCACAGTCTCTCTCCAT No data
Right 991209265 5:64085291-64085313 AGAGTGGTGTTGGCAGTCCAAGG No data
991209263_991209265 -8 Left 991209263 5:64085276-64085298 CCAGGGGATGCGGGAAGAGTGGT No data
Right 991209265 5:64085291-64085313 AGAGTGGTGTTGGCAGTCCAAGG No data
991209261_991209265 -2 Left 991209261 5:64085270-64085292 CCAGTGCCAGGGGATGCGGGAAG No data
Right 991209265 5:64085291-64085313 AGAGTGGTGTTGGCAGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991209265 Original CRISPR AGAGTGGTGTTGGCAGTCCA AGG Intergenic
No off target data available for this crispr