ID: 991210168

View in Genome Browser
Species Human (GRCh38)
Location 5:64095232-64095254
Sequence CTCAAGCACCAATAGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991210168_991210171 22 Left 991210168 5:64095232-64095254 CCAAGTAGCTATTGGTGCTTGAG No data
Right 991210171 5:64095277-64095299 TCAGTGAAATAAAATGGAGATGG No data
991210168_991210170 16 Left 991210168 5:64095232-64095254 CCAAGTAGCTATTGGTGCTTGAG No data
Right 991210170 5:64095271-64095293 TCAAACTCAGTGAAATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991210168 Original CRISPR CTCAAGCACCAATAGCTACT TGG (reversed) Intergenic
No off target data available for this crispr