ID: 991210171

View in Genome Browser
Species Human (GRCh38)
Location 5:64095277-64095299
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991210168_991210171 22 Left 991210168 5:64095232-64095254 CCAAGTAGCTATTGGTGCTTGAG No data
Right 991210171 5:64095277-64095299 TCAGTGAAATAAAATGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr