ID: 991211784

View in Genome Browser
Species Human (GRCh38)
Location 5:64113840-64113862
Sequence CTTTTTGAGGTCATCATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991211784_991211786 -6 Left 991211784 5:64113840-64113862 CCATTGATGATGACCTCAAAAAG No data
Right 991211786 5:64113857-64113879 AAAAAGAATTATTTTTCTAGAGG No data
991211784_991211787 3 Left 991211784 5:64113840-64113862 CCATTGATGATGACCTCAAAAAG No data
Right 991211787 5:64113866-64113888 TATTTTTCTAGAGGAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991211784 Original CRISPR CTTTTTGAGGTCATCATCAA TGG (reversed) Intergenic
No off target data available for this crispr