ID: 991212406

View in Genome Browser
Species Human (GRCh38)
Location 5:64120870-64120892
Sequence CTGAGTAAGGTGAAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991212400_991212406 7 Left 991212400 5:64120840-64120862 CCTGGGCCTCTAGTCTGATTCAT No data
Right 991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG No data
991212402_991212406 1 Left 991212402 5:64120846-64120868 CCTCTAGTCTGATTCATACTGGA No data
Right 991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991212406 Original CRISPR CTGAGTAAGGTGAAGAGGGA AGG Intergenic
No off target data available for this crispr