ID: 991213901

View in Genome Browser
Species Human (GRCh38)
Location 5:64138830-64138852
Sequence TTGAGTATGTACCTCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991213901_991213905 5 Left 991213901 5:64138830-64138852 CCCACACTGAGGTACATACTCAA No data
Right 991213905 5:64138858-64138880 TGAAGGCCAAGGACAAAGACAGG No data
991213901_991213904 -6 Left 991213901 5:64138830-64138852 CCCACACTGAGGTACATACTCAA No data
Right 991213904 5:64138847-64138869 ACTCAAACTGTTGAAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991213901 Original CRISPR TTGAGTATGTACCTCAGTGT GGG (reversed) Intergenic